SlideShare a Scribd company logo
1 of 20
Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
Aptamers ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Aptamers exist naturally ,[object Object]
In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
Aptamers that target cell surface receptors can be used for delivery of cargoes to cells ,[object Object],[object Object],[object Object],Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78  Anti-PSMA aptamer Anti-hTfR aptamer Anti-Tenascin C aptamer Aptamers can be used to target  in vivo
Cancer/Aptamer projects  underway in my lab ,[object Object],[object Object],[object Object],[object Object],[object Object]
The transferrin receptor (TfR, CD71)  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Selection for aptamers targeting the transferrin receptor ,[object Object],[object Object]
Anti-TfR aptamers label multiple human cancer cell lines  FACs based analysis using AF488 labeled aptamer
Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
Prostate-specific membrane antigen ,[object Object],[object Object],[object Object],[object Object],[object Object],Using a library based on the A9 aptamer we have now performed a ‘doped’ selection Cytoplasmic domain Transmembrane domain Extracellular domain NH 2 COOH Catalytic domain NH 2 COOH Catalytic domain
Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC  (68) Linsley Kelly Heavily mutagenize (30%) Reselect  (HeLa-PSMA cells)
Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC  (68) Linsley Kelly
[object Object]
Targeting DEC 205  ,[object Object],[object Object],[object Object],[object Object]
Targeting cell surface receptors with aptamers anti-DEC205 ,[object Object],[object Object]
[object Object],Brian Wengerter Anti-DEC205 aptamers bind CHO cells that express DEC205
[object Object],[object Object],Brian Wengerter
Summary ,[object Object],[object Object],[object Object],[object Object]
Acknowledgements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]

More Related Content

What's hot

Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Thermo Fisher Scientific
 
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
QIAGEN
 

What's hot (20)

Applications of Single Cell Analysis
Applications of Single  Cell AnalysisApplications of Single  Cell Analysis
Applications of Single Cell Analysis
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
 
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionTaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
 
CRISPR /Cas9
CRISPR /Cas9CRISPR /Cas9
CRISPR /Cas9
 
Clinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceClinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidance
 
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of  Viral vectors for gene and cell therapy appli...Production and purification of  Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014
 
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
 
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationDr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
 
mRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsmRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative Biolabs
 
Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering
 
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
 
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
 
Lepow Day Poster 2
Lepow Day Poster 2Lepow Day Poster 2
Lepow Day Poster 2
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
 
Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell Poster
 
Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9
 
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchDeveloping Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
 

Similar to Session 5.3 Levy

PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISH
tcha163
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013
Elsa von Licy
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And Egfr
Jessica Myers
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Thermo Fisher Scientific
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
Michael Powell
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287
Beth Salazar
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Thermo Fisher Scientific
 

Similar to Session 5.3 Levy (20)

An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISH
 
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAvs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogens
 
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
 
targeting
targetingtargeting
targeting
 
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsChimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013
 
IJAA
IJAAIJAA
IJAA
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And Egfr
 
NEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxNEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptx
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
 
3targeting
3targeting3targeting
3targeting
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287
 
ICAAC 2013: Resumen
ICAAC 2013: ResumenICAAC 2013: Resumen
ICAAC 2013: Resumen
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx
 
Aptamers
AptamersAptamers
Aptamers
 
EACR-P0ster-17
EACR-P0ster-17EACR-P0ster-17
EACR-P0ster-17
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
 
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
 

More from Albert Einstein Cancer Center

More from Albert Einstein Cancer Center (20)

Advances Agenda Slide 2016
Advances Agenda Slide 2016Advances Agenda Slide 2016
Advances Agenda Slide 2016
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
000 agenda
000   agenda000   agenda
000 agenda
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using My NCBI & My Bibliography
Using My NCBI & My BibliographyUsing My NCBI & My Bibliography
Using My NCBI & My Bibliography
 
Nih public access_policy
Nih public access_policyNih public access_policy
Nih public access_policy
 
Guide for My Bibliography and Compliance
Guide for My Bibliography and ComplianceGuide for My Bibliography and Compliance
Guide for My Bibliography and Compliance
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
NCICC with socialmedia
NCICC with socialmediaNCICC with socialmedia
NCICC with socialmedia
 
04.2 kurland pc
04.2 kurland pc04.2 kurland pc
04.2 kurland pc
 
03.1 libutti pc
03.1 libutti pc03.1 libutti pc
03.1 libutti pc
 
02.3 gabeau mac
02.3 gabeau mac02.3 gabeau mac
02.3 gabeau mac
 
02.2 kaubisch pc
02.2 kaubisch pc02.2 kaubisch pc
02.2 kaubisch pc
 
02.1 kinkhabwala
02.1 kinkhabwala02.1 kinkhabwala
02.1 kinkhabwala
 
01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web
 
01.4 steidl pc for upload
01.4 steidl pc for upload01.4 steidl pc for upload
01.4 steidl pc for upload
 
01.3 klampfer pc
01.3 klampfer pc01.3 klampfer pc
01.3 klampfer pc
 

Recently uploaded

Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Dipal Arora
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
perfect solution
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Dipal Arora
 

Recently uploaded (20)

VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 

Session 5.3 Levy

  • 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
  • 2.
  • 3.
  • 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
  • 5.
  • 6.
  • 7.
  • 8.
  • 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
  • 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
  • 11.
  • 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
  • 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
  • 14.
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.

Editor's Notes

  1. 20070212 combination of all data
  2. 20070212 combination of all data